paper-1

ABSTRACT



Many researches in the life sciences today are focused on DNA, identifying the critical sequences within genes that govern health and disease. Increasingly, this analysis demands vast computational resources. DNA (DeoxyriboNucleic Acid) molecules, the material our genes are made of, have the potential to perform calculations many times faster than the world's most powerful human-built computers.

A DNA-based computer has solved a logic problem that no person could complete by hand, setting a new milestone for this infant technology that could someday surpass the electronic digital computer in certain areas.DNA computing is useful because it has a capacity lacked by all current electronics-based computers. A DNA computer, as the name implies, uses DNA strands to store information and taps the recombinative properties of DNA to perform operations.

In 1994, Leonard Adleman, a computer scientist at the University of Southern California introduced the idea of using DNA to solve complex mathematical problems. So, Adleman is often called the inventor of DNA computers. The best way to understand the processing power of recombination is to look at an example. This presentation contains a computational process for a classic problem in logistics called "The Traveling Salesman” and NP-Hard Problems. But, DNA computing will likely focus on small-scale applications rather than the building of full-blown computers. The future of DNA manipulation is speed, automation, and miniaturization.


CONTENTS


 Introduction
 What Is DNA?
 What Is DNA Computer?
 The Adleman experiment
 Caveats -- Practical limitations
 DNA Components & Chips
 DNA Vs. Silicon:
 Conclusion
 Bibliography




DNA COMPUTING


Introduction:

The twentieth century will be remembered for three major achievements – The evolution of computers, decoding of the human genome and evolution from Newtonian physics to quantum physics. Since the beginning of time man has performed computations or calculation. The method and nature of these computations has however changed from manual in the stone ages to mechanical in the medieval ages to electronic in the new computer age.

What is going to be the future of computing systems? Can we look beyond silicon to embrace other mediums for computing? Computers inspired by biological or physical systems are possible alternatives. Microprocessors made of silicon will eventually reach their limits of speed and miniaturization. Chip makers need a new material to produce faster computing speeds.
You won't believe where scientists have found the new material they need to build the next generation of microprocessors. Millions of natural supercomputers exist inside living organisms, including your body. DNA (Deoxyribo Nucleic Acid) molecules, the material our genes are made of, have the potential to perform calculations many times faster than the world's most powerful human-built computers.
A DNA-based computer has solved a logic problem that no person could complete by hand, setting a new milestone for this infant technology that could someday surpass the electronic digital computer in certain areas. DNA might one day be integrated into a computer chip to create a so-called Biochip that will push computers even faster. DNA molecules have already been harnessed to perform complex mathematical problems.
What Is DNA?
An individual's DNA is unique, and various, fairly simple tests let DNA samples found at the scene of a crime be matched with the person who left it. You have probably heard of the DNA molecule referred to as the "double-helix." DNA is like two strings twisted together in a long spiral.
DNA is found in all cells as base pairs made of four different nucleotides. Each base pair is formed from two complementary nucleotides bonded together. The four bases in DNA's alphabet are:




• Adenine
• Cytosine
• Guanine
• Thymine




Adenine and thymine always bond together as a pair, and cytosine and guanine bond together as a pair. The pairs link together like rungs in a ladder:


Base pairs in DNA bond together to form a ladder-like structure. Because bonding occurs at angles between the bases, the whole structure twists into a helix.


What Is DNA Computer?
A DNA computer, as the name implies, uses DNA strands to store information and taps the recombinative properties of DNA to perform operations. A small test tube of DNA strands suspended in a solution could yield millions to billions of simultaneous interactions at speeds — in theory — faster than today's fastest supercomputers.
In a traditional computer, data are represented by and stored as strings of zeros and ones. With a DNA computer, a sequence of its four basic nucleotides — adenine, cytosine, guanine, and thymine — is used to represent and store data on a strand of DNA. Calculations in a traditional computer are performed by moving data into a processing unit where binary operations are performed. Essentially, the operations turn miniaturized circuits off or on corresponding to the zeros and ones that represent the string of data.
DNA computers can't be found at your local electronics store yet. The technology is still in development, and didn't even exist as a concept a decade ago. In 1994, Leonard Adleman introduced the idea of using DNA to solve complex mathematical problems. Adleman, a computer scientist at the University of Southern California, came to the conclusion that DNA had computational potential after reading the book "Molecular Biology of the Gene," written by James Watson, who co-discovered the structure of DNA in 1953. In fact, DNA is very similar to a computer hard drive in how it stores permanent information about your genes.
The Adleman experiment:
Adleman is often called the inventor of DNA computers. Also he is one of the creators of one of the strongest encryption algorithms called RSA. His article in a 1994 issue of the journal Science outlined how to use DNA to solve a well-known mathematical problem, called the directed Hamilton Path problem, also known as the "traveling salesman" problem. The goal of the problem is to find the shortest route between a number of cities, going through each city only once. As you add more cities to the problem, the problem becomes more difficult. Adleman chose to find the shortest route between seven cities.
You could probably draw this problem out on paper and come to a solution faster than Adleman did using his DNA test-tube computer. Here are the steps taken in the Adleman DNA computer experiment:


1. Strands of DNA represent the seven cities. In genes, genetic coding is represented by the letters A, T, C and G. Some sequence of these four letters represented each city and possible flight path.
2. These molecules are then mixed in a test tube, with some of these DNA strands sticking together. A chain of these strands represents a possible answer.
3. Within a few seconds, all of the possible combinations of DNA strands, which represent answers, are created in the test tube.
4. Adleman eliminates the wrong molecules through chemical reactions, which leaves behind only the flight paths that connect all seven cities.
There is no better way to understand how something works than by going through an example step by step. So let’s solve our own directed Hamiltonian Path problem, using the DNA methods demonstrated by Adleman.. Suppose that I live in LA, and need to visit four cities: Houston, Chicago, Miami, and NY, with NY being my final destination. The airline I’m taking has a specific set of connecting flights that restrict which routes I can take. What should my itinerary be if I want to visit each city only once?


It should take you only a moment to see that there is only one route. Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to N.Y. Any other choice of cities will force you to miss a destination, visit a city twice, or not make it to N.Y. For this example you obviously don’t need the help of a computer to find a solution. For six, seven, or even eight cities, the problem is still manageable. However, as the number of cities increases, the problem quickly gets out of hand. Assuming a random distribution of connecting routes, the number of itineraries you need to check increases exponentially. Pretty soon you will run out of pen and paper listing all the possible routes, and it becomes a problem for a computer......or perhaps DNA. The method Adleman used to solve this problem is basically the shotgun approach mentioned previously. He first generated all the possible itineraries and then selected the correct itinerary. This is the advantage of DNA. It’s small and there are combinatorial techniques that can quickly generate many different data strings. Since the enzymes work on many DNA molecules at once, the selection process is massively parallel.
Specifically, the method based on Adleman’s experiment would be as follows:
1. Generate all possible routes.
2. Select itineraries that start with the proper city and end with the final city.
3. Select itineraries with the correct number of cities.
4. Select itineraries that contain each city only once.
All of the above steps can be accomplished with standard molecular biology techniques.


Part I: Generate all possible routes
Los Angeles GCTACG
Chicago CTAGTA
Dallas TCGTAC
Miami CTACGG
New York ATGCCG
Strategy: Encode city names in short DNA sequences. Encode itineraries by connecting the city sequences for which routes exist.DNA can simply be treated as a string of data. For example, each city can be represented by a "word" of six bases:


The entire itinerary can be encoded by simply stringing together these DNA
sequences that represent specific cities. For example, the route from L.A -> Chicago -> Dallas -> Miami -> NewYork would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence.
So how do we generate this? Synthesizing short single stranded DNA is now a routine process, so encoding the city names is straightforward. The molecules can be made by a machine called a DNA synthesizer or even custom ordered from a third party. Itineraries can then be produced from the city encoding by linking them together in proper order. To accomplish this you can take advantage of the fact that DNA hybridizes with its complimentary sequence. For example, you can encode the routes between cities by encoding the compliment of the second half (last three letters) of the departure city and the first half (first three letters) of the arrival city.



For example the route between Miami (CTACGG) and NY (ATGCCG) can be made by taking the second half of the coding for Miami (CGG) and the first half of the coding for NY (ATG). This gives CGGATG. By taking the complement of this you get, GCCTAC, which not only uniquely represents the route from Miami to NY, but will connect the DNA representing Miami and NY by hybridizing itself to the second half of the code representing Miami (...CGG) and the first half of the code representing NY (ATG...).
Random itineraries can be made by mixing city encodings with the route encodings. Finally, the DNA strands can be connected together by an enzyme called ligase. What we are left with are strands of DNA representing itineraries with a random number of cities and random set of routes.


For example:
We can be confident that we have all possible combinations including the correct one by using an excess of DNA encodings, say 10^13 copies of each city and each route between cities. Remember DNA is a highly compact data format, so numbers are on our side.
Part II: Select itineraries that start and end with the correct cities
Strategy: Selectively copy and amplify only the section of the DNA that starts with LA and ends with NY by using the Polymerase Chain Reaction.
After Part I, we now have a test tube full of various lengths of DNA that encode possible routes between cities. What we want are routes that start with LA and end with NY. To accomplish this we can use a technique called Polymerase Chain Reaction(PCR), which allows you to produce many copies of a specific sequence of DNA. PCR is an iterative process that cycles through a series of copying events using an enzyme called polymerase. Polymerase will copy a section of single stranded DNA starting at the position of a primer, a short piece of DNA complimentary to one end of a section of the DNA that you're interested in. By selecting primers that flank the section of DNA you want to amplify, the polymerase preferentially amplifies the DNA between these primers, doubling the amount of DNA containing this sequence. After many iterations of PCR, the DNA you're working on is amplified exponentially. So to selectively amplify the itineraries that start and stop with our cities of interest, we use primers that are complimentary to LA and NY. What we end up with after PCR is a test tube full of double stranded DNA of various lengths, encoding itineraries that start with LA and end with NY.
Part III: Select itineraries that contain the correct number of cities.
Strategy: Sort the DNA by length and select the DNA whose length corresponds to 5 cities.



Our test tube is now filled with DNA encoded itineraries that start with LA and end with NY, where the number of cities in between LA and NY varies. We now want to select those itineraries that are five cities long. To accomplish this we can use a technique called Gel Electrophoresis, which is a common procedure used to resolve the size of DNA. The basic principle behind Gel Electrophoresis is to force DNA through a gel matrix by using an electric field. DNA is a negatively charged molecule under most conditions, so if placed in an electric field it will be attracted to the positive potential. However since the charge density of DNA is constant long pieces of DNA move as fast as short pieces when suspended in a fluid. This is why you use a gel matrix. The gel is made up of a polymer that forms a meshwork of linked strands. The DNA now is forced to thread its way through tiny spaces between these strands, which slows down the DNA at different rates depending on its length. What we typically end up with after running a gel is a series of DNA bands, with each band corresponding to a certain length. We can then simply cut out the band of interest to isolate DNA of a specific length. Since we known that each city is encoded with 6 base pairs of DNA, knowing the length of the itinerary gives us the number of cities. In this case we would isolate the DNA that was 30 base pairs long.

Part IV: Select itineraries that have a complete set of cities
Strategy: Successively filter the DNA molecules by city, one city at a time. Since the DNA we start with contains five cities, we will be left with strands that encode each city once.
DNA containing a specific sequence can be purified from a sample of mixed DNA by a technique called affinity purification. This is accomplished by attaching the compliment of the sequence in question to a substrate like a magnetic bead. The beads are then mixed with the DNA. DNA, which contains the sequence you're after then hybridizes with the complement sequence on the beads. These beads can then be retrieved and the DNA isolated.

So we now affinity purify fives times, using a different city complement for each run.

For example, for the first run we use L.A.'-beads to fish out DNA sequences which contain the encoding for L.A., the next run we use Dallas'-beads, and then Chicago'-beads, Miami'-beads, and finally NY'-beads. The order isn’t important. If an itinerary is missing a city, then it will not be "fished out" during one of the runs and will be removed from the candidate pool. What we are left with are the are itineraries that start in LA, visit each city once, and end in NY. This is exactly what we are looking for. If the answer exists we would retrieve it at this step.
Reading out the answer
One possible way to find the result would be to simply sequence the DNA strands. However, since we already have the sequence of the city encodings we can use an alternate method called graduated PCR. Here we do a series of PCR amplifications using the primer corresponding to L.A., with a different primer for each city in succession. By measuring the various lengths of DNA for each PCR product we can piece together the final sequence of cities in our itinerary. For example, we know that the DNA itinerary starts with LA and is 30 base pairs long, so if the PCR product for the LA and Dallas primers was 24 base pairs long, you know Dallas is the fourth city in the itinerary. Finally, if we were careful in our DNA manipulations the only DNA left in our test tube should be DNA itinerary encoding LA, Chicago, Miami, Dallas, and NY. So if the succession of primers used is LA & Chicago, LA & Miami, LA & Dallas, and LA & NY, then we would get PCR products with lengths 12,18,24,and 30 base pairs.
Caveats--Practical limitations:
Adleman's experiment solved a seven city problem, but there are two major shortcomings preventing a large scaling up of his computation. The complexity of the traveling salesman problem simply doesn’t disappear when applying a different method of solution - it still increases exponentially. For Adleman’s method, what scales exponentially is not the computing time, but rather the amount of DNA. Unfortunately this places some hard restrictions on the number of cities that can be solved; after the Adleman article was published, more than a few people have pointed out that using his method to solve a 200 city HP problem would take an amount of DNA that weighed more than the earth. Another factor that places limits on his method is the error rate for each operation. Since these operations are not deterministic but stochastically driven, each step contains statistical errors, limiting the number of iterations you can do successively before the probability of producing an error becomes greater than producing the correct result. For example an error rate of 1% is fine for 10 iterations, giving less than 10% error, but after 100 iterations this error grows to 63%.
Such practical obstacles are leading many in the field to look for more modest applications for the technology. "It's possible that we could use DNA computers to control chemical and biological systems in a way that's analogous to the way we use electronic computers to control electrical and mechanical systems," Adleman said. Despite its promise, the long-term prospects for DNA computing remain uncertain. The notion of full-scale DNA computing systems replacing silicon-based computers anytime soon, if ever, is remote. For the foreseeable future — and as its pioneer Adleman suggests — DNA computing will likely focus on small-scale applications rather than the building of full-blown computers.
Adleman and his colleagues solved a 3-SAT hard non-deterministic polynomial (NP) time problem. A hard NP problem is one in which the time required for algorithms to find a solution increases exponentially with the number of variables involved. A hard NP problem can eat up a lot of computer cycles if carried out by brute force. For example, the Hamilton path problem commonly known as the traveling salesman problem is a hard NP problem. If there are N cities in a Hamilton path problem, there are N!/2 possible paths, where N! is N factorial, which is the multiplication of every integer from 1 to N for example, 4!= 1 x 2 x 3 x 4.
The experiment by Smith's group tried something different. The group tackled a type of NP problem in which the answer is found by determining a solution that simultaneously satisfies a number of conditions, called clauses, each of which has three variables that can be true or false. Such a 3-SAT problem requires 1.6 million steps to solve using a traditional computer algorithm; it took only 91 steps using their modified DNA computing approach.
DNA Components & Chips
Information specifying a computational problem too complex for even a supercomputer is encoded in DNA. Then various molecular-biological tools are used to process this information. In a hot-tub sized vat of DNA, at normal laboratory concentration, one might easily imagine having 1021 DNA molecules, each potentially encoding 400 bits of information.



That's 100,000 billion times as much information as you can store in your 1 gigabyte hard disk. Each of these molecules acts, in a sense, as a separate processor in a giant multiprocessor. So, in effect, we have a thousand billion billion processors. When compared to conventional computers, certain operations in DNA computing are over a billion times more energy efficient. Also, DNA stores information at a density of about one bit per nm3—about a trillion times as efficiently as videotape. DNA computing is also massively parallel and can reach approximately 1020 operations per second compared to today’s teraflop supercomputers.
DNA: A unique data structure. The data density of DNA is impressive. Another important property of DNA is its double stranded nature. It's this cellular machinery, along with some synthetic chemistry, that makes up the palette of operations available for computation. Just like a CPU has a basic suite of operations like addition, bit-shifting, logical operators (AND, OR, NOT NOR), etc. that allow it to perform even the most complex calculations, DNA has cutting, copying, pasting, repairing, and many others. And note that in the test tube, enzymes do not function sequentially, working on one DNA at a time. Rather, many copies of the enzyme can work on many DNA molecules simultaneously. This is the power of DNA computing, that it can work in a massively parallel fashion.
DNA Vs. Silicon:
Typically, increasing performance of silicon computing means faster clock cycles, where the emphasis is on the speed of the CPU and not on the size of the memory but for DNA computing, though, the power comes from the memory capacity and parallel processing.
If DNA processing is allowed to work sequentially as with silicon processing it looses its appeal, e.g. In bacteria, DNA can be replicated at a rate of about 500 base pairs a second which is only 1000 bits/sec, which is a snail's pace when compared to the data throughput of an average hard drive. But look what happens if you allow many copies of the replication enzymes to work on DNA in parallel. First of all, the replication enzymes can start on the second replicated strand of DNA even before they're finished copying the first one. So already the data rate jumps to 2000 bits/sec. But look what happens after each replication is finished - the number of DNA strands increases exponentially. With each additional strand, the data rate increases by 1000 bits/sec. So after 10 iterations, the DNA is being replicated at a rate of about 1Mbit/sec; after 30 iterations it increases to 1000 Gbits/sec. This is beyond the sustained data rates of the fastest hard drives.
The difficulty of identifying the correct answer, compounded by the errors inherent to the technique might put considerable obstacles in the path of future progress. Moreover, no killer application has emerged so far, which might spur progress in the field. In fact till today a practical mathematical problem that would justify the use of massive parallelism achieved by the DNA computations has not been developed. Therefore you might have to wait some time for DNA to replace the silicon on your computer. A sub-field of this technology is DNA self-assembly, where the bonding properties of DNA molecules are used to build uniform DNA structures (DNA tiling), which could possibly serve as scaffolds for constructing nanostructures.



Figure 2: A truncated octahedron constructed from DNA. Ultimate goals for this approach include the assembly of a biochip computer and the synthesis of periodic matter. Using this methodology to do DNA computations might also be possible.
Applications:
The current applications of DNA chips are restricted to the field of medicine. Many top scientist believe that these DNA chips would be the able to unravel the mysteries of complex life and produce a host of new drugs. Affymetrix Inc pioneered the research in the field of DNA medicine. The company is widely credited as a visionary -- for its ingenious translation of computer chip-making technology to the world of biology and for anticipating a market that has only come of age with the deciphering of the human genetic code.
However now many companies such as Motorola and Corning and the Hewlett-Packard spinoff Agilent Technologies have joined this rapidly growing technology. Each of these challengers is applying its industrial expertise to making its own DNA microarrays or chips. DNA chips or arrays have been used to solve many problems in the field of medicine – some methods have been suggested to solve AIDS. One type of chip, developed by Affymetrix in Santa Clara, Calif., is programmed with between 65,000 and 400,000 clusters of unique DNA strips, each probe with a specific string of A’s, T’s, C’s, and G’s and a known location. By detecting where on the chip the DNA in question binds most tightly, a computer can reconstruct the exact chemical lettering of the unknown DNA.
Conclusion
So will DNA ever be used to solve a traveling salesman problem with a higher number of cities than can be done with traditional computers? This first demonstration of DNA computing used a rather unsophisticated algorithm, but as the formalism of DNA computing becomes refined, new algorithms perhaps will one day allow DNA to overtake conventional computation and set a new record.

Currently, molecular computing is a field with a great deal of potential, but few results of practical value. In the wake of Adleman's solution of the Hamiltonian path problem, there came a host of other articles on computation with DNA; however, most of them were purely theoretical. Currently, a functional DNA "computer" of the type most people are familiar with lies many years in the future. But work continues: in his article Speeding Up Computation via Molecular Biology Lipton shows how DNA can be used to construct a Turing machine, a universal computer capable of performing any calculation. While it currently exists only in theory, it's possible that in the years to come computers based on the work of Adleman, Lipton, and others will come to replace traditional silicon-based machines.
The Human Genome Project is producing rapid innovations in sequencing technology. The future of DNA manipulation is speed, automation, and miniaturization. Perhaps it won’t be used to play Quake IV / surf the web things that traditional computers are good at but it certainly might be used in the study of logic, encryption, genetic programming and algorithms, automata, language systems, and lots of other interesting things that haven't even been invented yet.
Bibliography
 Adleman, L.M., Molecular computation of solutions to combinatorial problems, Science, 226 (1994), 1021-1024.
 Paun, G., Computing with Bio-Molecules, Springer-Verlag, 1998.